WAR BETWEEN WORLDS(MY ORIGINAL DESIGNS)

By definition, HALEU is enriched between 5% and 20% and is required for most U.S. advanced reactors to achieve smaller designs that get more power per unit of volume. HALEU will also allow developers to optimize their systems for longer life cores, increased efficiencies and better fuel utilization. Distance between dining table and furniture: 36 inches. Ideally, you want to leave enough space between the table and a piece of furniture, such as a buffet or bar cart, to allow enough room for guests to walk behind chairs while others are seated or to open a drawer or cabinet when you need to get an item out.

2021.11.29 07:48 Ok_Quality416 WAR BETWEEN WORLDS(MY ORIGINAL DESIGNS)

WAR BETWEEN WORLDS(MY ORIGINAL DESIGNS) submitted by Ok_Quality416 to NFTCollect [link] [comments]


2021.11.29 07:48 HDaniel_54 Forgot to post thanksgiving turkey, this is the way y’all hot and fast over low and slow

Forgot to post thanksgiving turkey, this is the way y’all hot and fast over low and slow submitted by HDaniel_54 to smoking [link] [comments]


2021.11.29 07:48 assagitaz Lydia - Mountain Lake [Altar Records Europe]

Publisher: Altar Records Europe
Out Date: 2021-11-26
Quality: MP3 36.00 Mb / AIFF 158.61 Mb
Genre: Electronica
Lydia - Mountain Lake / (Key Dm, BPM 119, Length 14:59)​
DOWNLOAD - https://progonlymusic.com/index.php?route=release/release&release_id=509934
submitted by assagitaz to progonlydj [link] [comments]


2021.11.29 07:48 elideen Friendship is so broken.

I was rematching Byron and my scizor avoided death from his steelix 5 times in a row because it loves me lol. 1 hp for 5 moves straight wth is that.
submitted by elideen to PokemonBDSP [link] [comments]


2021.11.29 07:48 twboi COBALION on me NOW 564260256643

will add 5 only
submitted by twboi to PokemonGoFriends [link] [comments]


2021.11.29 07:48 WcE_Hellb0y I’m looking for anyone reselling this hoodie. I’ll take literally any size from L-XXL. I desperately wanted this hoodie and was about to buy it then it sold out.

I’m looking for anyone reselling this hoodie. I’ll take literally any size from L-XXL. I desperately wanted this hoodie and was about to buy it then it sold out. submitted by WcE_Hellb0y to plagueblvd [link] [comments]


2021.11.29 07:48 Karen-hunting Another airport Karen spotted, meet 'Mimosa Karen'

Another airport Karen spotted, meet 'Mimosa Karen' submitted by Karen-hunting to karens [link] [comments]


2021.11.29 07:48 magedl2 [3840x2160] Firewatch with Real sky (Custom edits)

submitted by magedl2 to wallpaper [link] [comments]


2021.11.29 07:48 ShrimpinAintEazy Keith Pitt's $50m gas subsidy survives abolition attempt, as most Labor senators abstain

Keith Pitt's $50m gas subsidy survives abolition attempt, as most Labor senators abstain submitted by ShrimpinAintEazy to australia [link] [comments]


2021.11.29 07:48 tipsyDr2 the entire handle is fondant

the entire handle is fondant submitted by tipsyDr2 to FondantHate [link] [comments]


2021.11.29 07:48 dreambringer1 Yacht

Yacht submitted by dreambringer1 to TaraReid [link] [comments]


2021.11.29 07:48 ashwincspl [For Hire][Remote]Fullstack Developer (Mobile/Web App Development)

Hi Reddit,
Need a mobile app built in iOS/Android? Would love to hear your ideas/projects and to turn them into meaningful, beautiful products together.
You can check our portfolio : https://complitech.us/work
Extensive expertise in iOS, Android, open to a new project. Popular tools, best practices, libraries, and design patterns are used to create apps that can be maintained and extended.
What can be offered?
• Help you get an idea to market.
• Design and develop iOS & Android applications to meet your requirements.
• Integrate cloud platforms such as AWS and Google App engine to reduce development cost and time.
• Update to date status updates
• Knowledge backend technology like Laravel and RoR for custom API and Admin panel development
• Ongoing support even after completion of project.
If you're interested please drop a chat or DM through Reddit.
Thanks!
Ash
submitted by ashwincspl to jobbit [link] [comments]


2021.11.29 07:48 florida_made_lit_jit How do you buy 160 robux?

I get the option on some gamepasses but I don't know how to buy it normally If i buy 160 robux on a gamepass does it spend it immediately?
submitted by florida_made_lit_jit to roblox [link] [comments]


2021.11.29 07:47 PenaltyAccording8800 OTIUM TECH GIVEAWAY! ☮️ | Utility Token: Revolutionizing the Hotel & Tourism Industry 🏨 | Low MC at TGE: 100x Potential 🚀 | BUY $OTIUM ON PANCAKESWAP!

☮️ $OTIUM GIVEAWAY!! 🚀 Spread OTIUM's word & WIN $1500 USD!! How to enter:
[https://twitter.com/otium\_tech/status/1461575034430898177?s=21](https://twitter.com/otium_tech/status/1461575034430898177?s=21)
☮️ OTIUM TECHNOLOGIES
Bringing blockchain to travel & tourism
We already launched! ❤️‍🔥
Where❓
PancakeSwap 🥞
✅ Presale filled in minutes ! (500BNB)
✅ Big Marketing Campaign & Listings after Launch
✅ Unique use case: Bringing blockchain to travel and tourism.
✅ Fully doxxed & transparent team
✅ Solidproof Audit & KYC
✅ Liquidity Locked & Team Tokens Vested
What is OTIUM❓
Otium provides solutions to large companies in the Hotel & Travel industry with a tool to capitalize through their own token while interacting and building customer loyalty in a new way, while user will 1have the possibility to feel part of their favorite brand, using loyalty tokens in a practical and simple way, either by voting, investing or to purchase brand’s products.
STRENGTHS
🔶Pioneers in the vacation leisure industry
🔶Senior team of industry experts
🔶Well-connected with major tourism companies
Join our social media below
➡️\\\[Telegram Otium Overseas Official\\\](\[[[https://t.me/otiumoverseas\]]]()https://t.me/otiumoverseas])
➡️\\\[Website\\\](\[[[http://www.otiumtechnologies.com/\]]]()http://www.otiumtechnologies.com/])
➡️\\\[Reddit\\\](\[[[https://www.reddit.com/OtiumTechnologies/\]]]()https://www.reddit.com/OtiumTechnologies/])
➡️\\\[Youtube\\\](\[[[https://www.youtube.com/watch?v=7HF\_RYltSQI\]]]()https://www.youtube.com/watch?v=7HF_RYltSQI])
➡️\\\[Whitepaper\\\](\[[[https://otiumtechnologies.com/wp-content/uploads/2021/09/OTIUM-WHITEPAPER\\\\\\\_ENG.pdf\\](https://otiumtechnologies.com/wp-content/uploads/2021/09/OTIUM-WHITEPAPER_ENG.pdf)\]
submitted by PenaltyAccording8800 to CryptoMoonCoins [link] [comments]


2021.11.29 07:47 wooondeeer If you have sex near a clap activated lamp you can get epilepsy real fast.

submitted by wooondeeer to Showerthoughts [link] [comments]


2021.11.29 07:47 According_Ad_177 Whay Is Entry Level Pay?

I have an interview coming up again finally after looking since graduating last year. The only experience I have on my resume so far is freelance work and being a previous day care teacher. Because of this the last interview I had the person only offered $12/hr for a part time position, which I didn't take. This new interview is also part time I believe. What is the starting range for graphic designers like myself in Philadelphia if anyone knows? I've tried looking it up and keep getting mixed ranges. Please help!
submitted by According_Ad_177 to graphic_design [link] [comments]


2021.11.29 07:47 AhmadNotFound I made another two mojavatars

I made another two mojavatars submitted by AhmadNotFound to Minecraft [link] [comments]


2021.11.29 07:47 4ny3ody How exp could be handled better

Since BDSPs release there has been a lot of discussion about the exp-share, it's boons and banes and the difficulty of Pokemon.
I want to make a suggestion that (hopefully) satisfies the demands of multiple people: Adjusting the exp based on level.
First I want to talk about the viewpoints I've seen most often: - Exp-share is good because the player isn't forced to grind - Exp-share is bad because players are overleveled unless they restrict themselves
I will not cover the exp-share should be optional (although I agree with it because player choice is good) as I personally enjoy exp-share, but lament the restrictions required to keep games challenging.
I believe everyone is aware of the changes made to the exp system back in gen5? Where you get less exp for defeating Pokemon that are a lower level? My solution is simple: Increase that in both directions. Harsher exp penalties for each level above opponents, larger exp-bonuses for each level below opponents.
What would this lead to in example scenarios: - You have chosen your team of 6 and want to stick with it throughout the whole game: Your team will constantly receive exp, but due to the harsher exp penalty will not overlevel opponents as easily.
- You just want to use everything you encounter and throughout your playthrough use 20+ mons and maybe even breed a Pokemon for egg moves: While only 6 of your Pokemon constantly receive exp, those that have not received exp in a while will catch up far more quickly. While overall the average level if your Pokemon is still lower, it can be made up for by making more team adjustments to each challenge.
- You have a core team but want to add a new member that you receive in a very underleveled state (eggs for example): Your core team will have constant exp but not overlevel in the process of getting your new Pokemon up to speed as the new member catches up faster and the core team receives a harsher exp-penalty.
Now for the difficulty part: Simply introduce a hard mode with higher levels on key opponents. Although it would be preferable if hard mode actually made changes to opponents teams to demand better strategizing by the player I wanted to be humble with my suggestion on this despite ILCA showing with their Elite 4 changes that they can in fact design good fights. Also please turn off attraction bonuses. RNG features like this are terrible for any well-designed difficulty.
With that being said though the imo currently best part of BDSP in the elite 4 poses a problem: Currently they represent too much of a level spike for my suggested system to work. Smooth out the level curves and bring the 4th to 8th Gym as well as Team Plasma closer to the elite 4.
Thank you to everyone who read this and I'd appreciate your thoughts on the matter.
submitted by 4ny3ody to pokemon [link] [comments]


2021.11.29 07:47 Reezpuffs03 Is the Deepcool RF120M compatible with Gigabyte B450M DS3H?

I will be buying case fans soon and I'm thinking if I should get the Deepcool RF120M.
Are these fans compatible with the said mobo in the title? Also, can I sync it to that mobo and use RGB Fusion 2.0 to control/change the lighting?
Can I also get your opinions on these fans? Are they good in terms of cooling and are they not loud?
Here is the link for the fans:
https://s.lazada.com.ph/s.e80GE
Thanks in advanced
submitted by Reezpuffs03 to buildapc [link] [comments]


2021.11.29 07:47 MancDP Position Up Text Animation Finesse

Hey, so I'm not particularly well versed in AE so this may be a super simple one.
I'm doing a simple text animation, just two words animating upwards letter by letter, using the range selector. However, it looks a little rough. I've played around with the speed and it looks better but still not achieving what I want.
The next letter of the word only starts animating upwards after the letter before has reached its final position. I want each letter to start animating before the letter before reaches its final position, I think it'll give the whole animation a more fluid feel but I can't figure out how to do it. Is there an easy way that animating each letter individually? if that's the best way then I guess I'll do that but just wanted to see if there was a quicker way!
Thanks
submitted by MancDP to AfterEffects [link] [comments]


2021.11.29 07:47 ComparisonCareless62 Joi

I give no limit joi as addison rea (If u dont want anything like assplay just say it)
submitted by ComparisonCareless62 to AddisonRE [link] [comments]


2021.11.29 07:47 JollyJadenTNT Captain Man and Kid Danger vs. MCU Iron Man and Spidey (Henry Danger vs. Marvel Studios) Battle Between the two young heroes and they're mentors!

Captain Man and Kid Danger vs. MCU Iron Man and Spidey (Henry Danger vs. Marvel Studios) Battle Between the two young heroes and they're mentors! submitted by JollyJadenTNT to DeathBattleMatchups [link] [comments]


2021.11.29 07:47 1909_SGD FUTUREWAVE & 36 CYPHER - Hell Sweet Home LP (via FXCK RXP) COMING SOON

FUTUREWAVE & 36 CYPHER - Hell Sweet Home LP (via FXCK RXP) COMING SOON submitted by 1909_SGD to AlbumArtPorn [link] [comments]


2021.11.29 07:47 Diopod136 Entry 10 - 29 Nov 11:00

Jesus Christ. I found a pornstar that looks 100% like my best friend/long time crush. This is going to be fun
She’s got the same height around, face shape, eyes, hair colour and length and even her glasses are the same colour.
I want her to suck my dick then mount me and ride me to oblivion in just a pleated skirt
submitted by Diopod136 to MasturbationJournal [link] [comments]


2021.11.29 07:47 melancoluxx Blast multiple sequences at once with NCBI blastn

Hi all,
I am designing pool of probes for fluorescent HCR in situ hybridization. I use blast (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch) to check the specificity of each probe by entering for instance "GACATTTACTTATGTGCAGAGAAAC XX CAATTTCCACGGACGCACTGACGTG" as the query and Mus Musculus as the Search Set.
I usually do it one by one but for a specific gene I end up with almost 200 pair of probes to check and would like to blast them all at once. Is there a way to do it on the cited website? I already tried to upload a file with all the probes as the query but it only blasted the first sequence of the list.
Thanks!
submitted by melancoluxx to bioinformatics [link] [comments]


http://moz-travel.ru